Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3734448
End position: 3734495
Length: 48

DNA sequence
>NC_014659, from 3734448 to 3734495 (48 bp); Rhodomicrobium equis 103S TCGGGCTCGGGCTCGGGCTCGGGCTCGGGCTCGGGCTCGGGCTCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3734046-3735455	Sequence	REQ_35170 - hypothetical protein (Protein is coded in complementary strand; from 3735455 to 3734046)