Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4980492
End position: 4980545
Length: 54

DNA sequence
>NC_014659, from 4980492 to 4980545 (54 bp); Rhodomicrobium equis 103S GGGGGCGGCCGGGGACTGGGGGGCGGCCGGGGACTGGGGGGCGGCCGGGGACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4980490-4982004	Sequence	REQ_46850 - glycosyl transferase family 2 (Protein is coded in complementary strand; from 4982004 to 4980490)