Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3755460
End position: 3755519
Length: 60

DNA sequence
>NC_014659, from 3755460 to 3755519 (60 bp); Rhodomicrobium equis 103S CTGCCGCCTGTTCCGGGGCCGCCTGTTCGGGGGCCGCCTGTTCGGGCGCCGACTGTTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3755273-3756922	Sequence	REQ_35380 - hypothetical protein (Protein is coded in complementary strand; from 3756922 to 3755273)