Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1003328
End position: 1003363
Length: 36

DNA sequence
>NC_014720, from 1003328 to 1003363 (36 bp); Caldicellulosiruptor kronotskyensis 2002 CAACACCAACACCGACACCAACACCAACAGTAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1002344-1006195	Sequence	Calkro_0851 - mannan endo-1,4-beta-mannosidase