Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1007969
End position: 1008022
Length: 54

DNA sequence
>NC_014720, from 1007969 to 1008022 (54 bp); Caldicellulosiruptor kronotskyensis 2002 CCAACACCAACATCAACAGCAACACCAACACCGACACCCACACCAGCACCAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1006806-1011236	Sequence	Calkro_0853 - cellulose 1,4-beta-cellobiosidase