Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1013028
End position: 1013057
Length: 30

DNA sequence
>NC_014720, from 1013028 to 1013057 (30 bp); Caldicellulosiruptor kronotskyensis 2002 AACACCAACCCCAACCCCAACCCCGACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1011392-1015057	Sequence	Calkro_0854 - mannan endo-1,4-beta-mannosidase