Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1028340
End position: 1028369
Length: 30

DNA sequence
>NC_014720, from 1028340 to 1028369 (30 bp); Caldicellulosiruptor kronotskyensis 2002 CCAACACCAACATCAACAGCAACACCAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1026007-1031517	Sequence	Calkro_0861 - cellulose 1,4-beta-cellobiosidase