Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1038134
End position: 1038187
Length: 54

DNA sequence
>NC_014720, from 1038134 to 1038187 (54 bp); Caldicellulosiruptor kronotskyensis 2002 CCAACAGCAACACCAACTCCAACCCCGACACCAAGACCAACGTCAACACCAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1036170-1038701	Sequence	Calkro_0864 - type 3a cellulose-binding domain-containing protein