Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1293234
End position: 1293258
Length: 25

DNA sequence
>NC_014720, from 1293234 to 1293258 (25 bp); Caldicellulosiruptor kronotskyensis 2002 TGAATTGGATGGAATTGAAAAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1292393-1294288	Sequence	Calkro_1126 - SMC domain-containing protein