Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 174925
End position: 174954
Length: 30

DNA sequence
>NC_014720, from 174925 to 174954 (30 bp); Caldicellulosiruptor kronotskyensis 2002 TTGACTTAAATTGGATTAAATTTACTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 171241-176160	Sequence	Calkro_0114 - coagulation factor 5/8 type domain-containing protein