Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1763304
End position: 1763366
Length: 63

DNA sequence
>NC_014720, from 1763304 to 1763366 (63 bp); Caldicellulosiruptor kronotskyensis 2002 GCAACTCTTTGCTCAACCATATCAAGTCTCTGCTCAACCATATCAAGTCTTTGCTCAATCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1763022-1763453	Sequence	Calkro_1593 - hypothetical protein (Protein is coded in complementary strand; from 1763453 to 1763022)