Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1820442
End position: 1820465
Length: 24

DNA sequence
>NC_014720, from 1820442 to 1820465 (24 bp); Caldicellulosiruptor kronotskyensis 2002 ATCCTTTTATCCTTTACTCCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1819365-1820660	Sequence	Calkro_1652 - sun protein (Protein is coded in complementary strand; from 1820660 to 1819365)