Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 1838159
End position: 1838188
Length: 30

DNA sequence
>NC_014720, from 1838159 to 1838188 (30 bp); Caldicellulosiruptor kronotskyensis 2002 TAATCTCTTCTCCTCTCTTCTTTTCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1836913-1838160	Sequence	Calkro_1671 - phenylacetate--CoA ligase (Protein is coded in complementary strand; from 1838160 to 1836913)