Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 2207640
End position: 2207663
Length: 24

DNA sequence
>NC_014720, from 2207640 to 2207663 (24 bp); Caldicellulosiruptor kronotskyensis 2002 AAAGGAAAAGCAAAAGTAAAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2204454-2207708	Sequence	Calkro_2019 - arabinogalactan endo-1,4-beta-galactosidase (Protein is coded in complementary strand; from 2207708 to 2204454)