Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 2543510
End position: 2543572
Length: 63

DNA sequence
>NC_014720, from 2543510 to 2543572 (63 bp); Caldicellulosiruptor kronotskyensis 2002 CTCTACCCTGTCAAGTCTTTCCTCTACTCTGTCAAGTCTTTCTTCTACTCTGTCAAGTCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2543118-2543693	Sequence	Calkro_2331 - hypothetical protein (Protein is coded in complementary strand; from 2543693 to 2543118)