Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 477444
End position: 477470
Length: 27

DNA sequence
>NC_014720, from 477444 to 477470 (27 bp); Caldicellulosiruptor kronotskyensis 2002 CTACTATTATTACTATTACTACTACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 476801-477574	Sequence	Calkro_0358 - capsular exopolysaccharide family