Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 890100
End position: 890123
Length: 24

DNA sequence
>NC_014720, from 890100 to 890123 (24 bp); Caldicellulosiruptor kronotskyensis 2002 ATTTTAATTTTGATTTCATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 890071-893868	Sequence	Calkro_0747 - Fibronectin type III domain-containing protein