Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 926350
End position: 926373
Length: 24

DNA sequence
>NC_014720, from 926350 to 926373 (24 bp); Caldicellulosiruptor kronotskyensis 2002 CTTTTAATTTTAATTTTAATTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 925447-926412	Sequence	Calkro_0779 - hypothetical protein (Protein is coded in complementary strand; from 926412 to 925447)