Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 952673
End position: 952697
Length: 25

DNA sequence
>NC_014720, from 952673 to 952697 (25 bp); Caldicellulosiruptor kronotskyensis 2002 AAAGTAAACTAAAGCGAAGTAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 951070-952680	Sequence	Calkro_0802 - extracellular solute-binding protein family 5