Sequence retrieval

Genome: Caldicellulosiruptor kronotskyensis 2002
Start position: 999039
End position: 999062
Length: 24

DNA sequence
>NC_014720, from 999039 to 999062 (24 bp); Caldicellulosiruptor kronotskyensis 2002 CACCAACTCCAACTCCAACACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 996999-1002188	Sequence	Calkro_0850 - cellulase., cellulose 1,4-beta-cellobiosidase