Sequence retrieval

Genome: Thermococcus barophilus MP
Start position: 1345279
End position: 1345308
Length: 30

DNA sequence
>NC_014804, from 1345279 to 1345308 (30 bp); Thermococcus barophilus MP TGGGATTTCTTGAGCTTTCTTGAGCTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1344980-1345915	Sequence	TERMP_01557 - ketoisovalerate oxidoreductase VorB-like subunit (Protein is coded in complementary strand; from 1345915 to 1344980)