Sequence retrieval

Genome: Thermococcus barophilus MP
Start position: 1568781
End position: 1568804
Length: 24

DNA sequence
>NC_014804, from 1568781 to 1568804 (24 bp); Thermococcus barophilus MP AATCACAATCGCCATCACAATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1568734-1569048	Sequence	TERMP_01778 - hypothetical protein (Protein is coded in complementary strand; from 1569048 to 1568734)