Sequence retrieval

Genome: Thermococcus barophilus MP
Start position: 575478
End position: 575507
Length: 30

DNA sequence
>NC_014804, from 575478 to 575507 (30 bp); Thermococcus barophilus MP AGAAAAGAAAAGAAAAGATGGGAGAAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 575442-577136	Sequence	TERMP_00670 - motifcytosolic fatty-acid binding proteins signature