Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 1024313
End position: 1024348
Length: 36

DNA sequence
>NC_014922, from 1024313 to 1024348 (36 bp); Haemophilus influenzae F3047 AGCACGACCAGAACGACCTGCACGACCAGTACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1023504-1025345	Sequence	HICON_12410 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 1025345 to 1023504)