Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 1053614
End position: 1053649
Length: 36

DNA sequence
>NC_014922, from 1053614 to 1053649 (36 bp); Haemophilus influenzae F3047 TAAGCTCGCTGGTAAGCTCGCTGGTAAGCTCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1052944-1054200	Sequence	HICON_12580 - type I restriction-modification system (Protein is coded in complementary strand; from 1054200 to 1052944)