Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 1252001
End position: 1252024
Length: 24

DNA sequence
>NC_014922, from 1252001 to 1252024 (24 bp); Haemophilus influenzae F3047 CAATTTCAATATCAATATCAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1251535-1254186	Sequence	HICON_14310 - hypothetical protein (Protein is coded in complementary strand; from 1254186 to 1251535)