Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 1536931
End position: 1536994
Length: 64

DNA sequence
>NC_014922, from 1536931 to 1536994 (64 bp); Haemophilus influenzae F3047 TTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1536113-1537000	Sequence	HICON_17020 - glycosyltransferase (Protein is coded in complementary strand; from 1537000 to 1536113)