Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 1739775
End position: 1739819
Length: 45

DNA sequence
>NC_014922, from 1739775 to 1739819 (45 bp); Haemophilus influenzae F3047 TTTGAGCCACTATAATTTGTTCCACTATAATTTGCTCCACTACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1739211-1739876	Sequence	HICON_00460 hafD pilin protein HafD (Protein is coded in complementary strand; from 1739876 to 1739211)