Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 1845367
End position: 1845411
Length: 45

DNA sequence
>NC_014922, from 1845367 to 1845411 (45 bp); Haemophilus influenzae F3047 TTTGAGCCACTATAATTTGTTCCACTATAATTTGCTCCACTACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1844803-1845468	Sequence	HICON_01430 hafD pilin protein HafD (Protein is coded in complementary strand; from 1845468 to 1844803)