Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 60321
End position: 60344
Length: 24

DNA sequence
>NC_014922, from 60321 to 60344 (24 bp); Haemophilus influenzae F3047 AAAATAAAAAGAAAAATCAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 58092-60458	Sequence	HICON_03370 rec-2 recombination protein 2 (Protein is coded in complementary strand; from 60458 to 58092)