Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 657082
End position: 657137
Length: 56

DNA sequence
>NC_014922, from 657082 to 657137 (56 bp); Haemophilus influenzae F3047 ATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 656965-657837	Sequence	HICON_08670 lic2A UDP-Gal--lipooligosaccharide galactosyltransferase