Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 662874
End position: 662900
Length: 27

DNA sequence
>NC_014922, from 662874 to 662900 (27 bp); Haemophilus influenzae F3047 CATTCCGCCCATTCCACCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 662869-664515	Sequence	HICON_08760 haef1A 60 kDa chaperonin (Protein is coded in complementary strand; from 664515 to 662869)