Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 701830
End position: 701857
Length: 28

DNA sequence
>NC_014922, from 701830 to 701857 (28 bp); Haemophilus influenzae F3047 AAAAATGACAAATGAAAAATTGAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 701835-702746	Sequence	HICON_09080 - 1,4-dihydroxy-2-naphthoate octaprenyltransferase