Sequence retrieval

Genome: Haemophilus influenzae F3047
Start position: 986668
End position: 986715
Length: 48

DNA sequence
>NC_014922, from 986668 to 986715 (48 bp); Haemophilus influenzae F3047 ATTGCCATTGCCATTGCCATTGCCATTGCCATTGCCATTGCCATTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 984368-987127	Sequence	HICON_12090 hxuA heme/hemopexin-binding protein A (Protein is coded in complementary strand; from 987127 to 984368)