Sequence retrieval

Genome: Methanobacterium sp. AL-21
Start position: 1433017
End position: 1433052
Length: 36

DNA sequence
>NC_015216, from 1433017 to 1433052 (36 bp); Methanobacterium sp. AL-21 ATTGCCAGCCCAAATGCCAGTCCAATTGCAAGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1432456-1433214	Sequence	Metbo_1426 - MiP family channel protein (Protein is coded in complementary strand; from 1433214 to 1432456)