Sequence retrieval

Genome: Methanobacterium sp. AL-21
Start position: 1467367
End position: 1467390
Length: 24

DNA sequence
>NC_015216, from 1467367 to 1467390 (24 bp); Methanobacterium sp. AL-21 CAAAATAAAAATCAACATCAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1466811-1468532	Sequence	Metbo_1456 - 2-oxoacid:acceptor oxidoreductase subunit alpha