Sequence retrieval

Genome: Methanobacterium sp. AL-21
Start position: 2538717
End position: 2538776
Length: 60

DNA sequence
>NC_015216, from 2538717 to 2538776 (60 bp); Methanobacterium sp. AL-21 CATTTCCGTTACCATTATCTCCATTACCATTGTTTCCATTACCATTGTTTCCATTACCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2538299-2540293	Sequence	Metbo_2495 - hypothetical protein (Protein is coded in complementary strand; from 2540293 to 2538299)