Sequence retrieval

Genome: Methanobacterium sp. AL-21
Start position: 617474
End position: 617497
Length: 24

DNA sequence
>NC_015216, from 617474 to 617497 (24 bp); Methanobacterium sp. AL-21 TTCTACTTCTTCTTCCACTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 616965-618191	Sequence	Metbo_0638 - roadblock/LC7 family protein (Protein is coded in complementary strand; from 618191 to 616965)