Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1277611
End position: 1277634
Length: 24

DNA sequence
>NC_015588, from 1277611 to 1277634 (24 bp); Isoptericola variabilis 225 CGTCGGCGTGGGCGCCGGCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1277238-1278863	Sequence	Isova_1167 - oxidoreductase molybdopterin binding protein