Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 887415
End position: 887444
Length: 30

DNA sequence
>NC_015588, from 887415 to 887444 (30 bp); Isoptericola variabilis 225 CGCGGCGGTGCGCGACGGCGCGCGGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 886700-888280	Sequence	Isova_0818 - peptidase M24 (Protein is coded in complementary strand; from 888280 to 886700)