Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 578952
End position: 579005
Length: 54

DNA sequence
>NC_015588, from 578952 to 579005 (54 bp); Isoptericola variabilis 225 CTCGTGACGCGTGCCCACCACGGGACCCGTGCCCACCACGGGACCCGTGCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 578006-578959	Sequence	Isova_0536 - Cro/CI family transcriptional regulator -like protein