Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1158380
End position: 1158403
Length: 24

DNA sequence
>NC_015588, from 1158380 to 1158403 (24 bp); Isoptericola variabilis 225 CCGGCTCGGGCTCCGGCGTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1156324-1158891	Sequence	Isova_1066 - aminopeptidase N (Protein is coded in complementary strand; from 1158891 to 1156324)