Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1235164
End position: 1235187
Length: 24

DNA sequence
>NC_015588, from 1235164 to 1235187 (24 bp); Isoptericola variabilis 225 CGGCTTGGGCTTTGGCTTCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1233287-1235566	Sequence	Isova_1133 - hypothetical protein (Protein is coded in complementary strand; from 1235566 to 1233287)