Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1266193
End position: 1266222
Length: 30

DNA sequence
>NC_015588, from 1266193 to 1266222 (30 bp); Isoptericola variabilis 225 CACGAGCGCGAGCACGATCCCGAGCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1265954-1266565	Sequence	Isova_1151 - hypothetical protein (Protein is coded in complementary strand; from 1266565 to 1265954)