Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1269486
End position: 1269509
Length: 24

DNA sequence
>NC_015588, from 1269486 to 1269509 (24 bp); Isoptericola variabilis 225 CCGCGAGCGCGATCGCGAGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1269473-1269565	Sequence	Isova_1156 - hypothetical protein (Protein is coded in complementary strand; from 1269565 to 1269473)