Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1382368
End position: 1382391
Length: 24

DNA sequence
>NC_015588, from 1382368 to 1382391 (24 bp); Isoptericola variabilis 225 CCGCGGCCGCGACCGCCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1381977-1382732	Sequence	Isova_1263 - SOS-response transcriptional repressor, LexA (Protein is coded in complementary strand; from 1382732 to 1381977)