Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1412549
End position: 1412572
Length: 24

DNA sequence
>NC_015588, from 1412549 to 1412572 (24 bp); Isoptericola variabilis 225 CGCCGCCGTCGCCGGCGCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1411909-1413057	Sequence	Isova_1290 - UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-UDP N- acetylglucosamine transferase