Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 143207
End position: 143242
Length: 36

DNA sequence
>NC_015588, from 143207 to 143242 (36 bp); Isoptericola variabilis 225 GCCGCGGGTGCCGGCGCGGGTGCTGGCGCGGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 142640-143512	Sequence	Isova_0132 - excalibur domain-containing protein (Protein is coded in complementary strand; from 143512 to 142640)