Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1535266
End position: 1535301
Length: 36

DNA sequence
>NC_015588, from 1535266 to 1535301 (36 bp); Isoptericola variabilis 225 GCGCTCGCCGAGGCGCTCGTCGGGGCGGTCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1534922-1536502	Sequence	Isova_1410 - UMUC domain-containing protein DNA-repair protein