Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1677489
End position: 1677512
Length: 24

DNA sequence
>NC_015588, from 1677489 to 1677512 (24 bp); Isoptericola variabilis 225 GGCCGGGACCGGGGGCGGGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1676606-1677784	Sequence	Isova_1541 - hypothetical protein (Protein is coded in complementary strand; from 1677784 to 1676606)